Flpo antibody

WebAAV pEF1a-DIO-FLPo-WPRE-hGHpA. Catalog No. PVT10893 Packing 2ug Function Mammal Editing plasmids Resistance Amp Screen / Strain Stbl3 Culture temperature 37degrees centigrade Replicon Copy ... CPE Antibody. $325.00. Write Review . Add to Cart. Add to Wishlist; Add to Compare; Write Review . Quick View. New. Human OLFM2 … WebListed below are anti-Flp antibodies from multiple suppliers. Flp is a reported alias name for the human gene HPD, or '4-hydroxyphenylpyruvate dioxygenase'. The 393 …

px330_DBH-p2a-FLPo vector map and sequence

WebPlasmid pAAV-EF1a-Flpo from Dr. Karl Deisseroth's lab contains the insert Flpo and is published in Nat Methods. 2014 Jul;11(7):763-72. doi: 10.1038/nmeth.2996. ... Learn … WebSee our retrograde AAV based on the functional catagories listed below. Narrow down the items available within a category by using the buttons. Controls Green Red Switch Other Recombinases Cre Flp VCre Dre Calcium Sensors GCaMP8f GCaMP8s GCaMP8m GCaMP7f GCaMP7s GCaMP7b GCaMP6f GCaMP6s GECO Other Biosensors … earthstone countertops https://mertonhouse.net

Addgene: pAAV-hSyn Con/Fon EYFP

WebJan 20, 2015 · Transgene expression profiles, anti-transgene antibody titers, and bone healing after implantation of BV- engineered pASCs into mini pigs. (A) Expression duration of bone morphogenetic protein 2 ... WebLearn more about Addgene materials from user-contributed reports describing AAV and antibody experiments. Sequence Analyzer. Basic analysis for a user-entered sequence; includes restriction sites and map. ... -FlpO-bGHpA: hSyn: none: rg* Zeng: 55634: pAAV-EF1a-mCherry-IRES-Flpo: EF1a: mCherry (not a fusion tag) 1, rg* Deisseroth: 55637: … Webflp recombinase Alt name EFS promoter driving FlpO recombinase Insert Size (bp) 212 Entrez Gene flp Promoter EF1a/EFS promoter inserted Cloning Information Cloning method Restriction Enzyme 5′ cloning site SnaI (destroyed during cloning) 3′ cloning site XbaI (not destroyed) 5′ sequencing primer ccagtacatgaccttatggg earthstone countertops gainesville georgia

Addgene: pFLPo

Category:Addgene: Pvalb-2A-Flpo Flp-in replacement vector

Tags:Flpo antibody

Flpo antibody

The Cre-lox and FLP-FRT systems - The Jackson Laboratory

WebNov 21, 2016 · The dual expression vector was used for the fluorescence lifetime imaging (FLIM) screen, the ratiometric screen (RFP brightness and green component), the photostability assay using widefield... WebSynapsin-driven, Cre-dependent and Flp-dependent channelrhodopsin-EYFP expression for optogenetic activation. These AAV preparations are suitable purity for injection into animals. Delivery Volume 100 µL Titer ≥ 7×10¹² vg/mL Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid. Storage Store at -80℃.

Flpo antibody

Did you know?

WebFlp recombinase originates from Saccharomyces cerevisiae and recognizes FRT sites in the genome. It catalyzes recombination between two FRT sites, thereby excising the … WebFlp (Flp recombinase) Polyclonal Antibody validated in WB and ELISA. Batch-specific data available on the website. Polyclonal antibody raised in rabbit against Flp recombinase …

WebFLPo is a mouse codon-optimized FLP. How to cite this plasmid ( Back to top ) These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were … WebPvalb-2A-Flpo Flp-in replacement vector (Plasmid #61572) Print Enlarge View all sequences Purpose Recombinase-mediated cassette exchange in ES cells to insert the Flpo recombinase gene at the mouse Pvalb gene …

WebGrowth in Bacteria Bacterial Resistance (s) Ampicillin, 100 μg/mL Growth Temperature 37°C Growth Strain (s) DH5alpha Copy number High Copy Gene/Insert Gene/Insert name FlpO-2A-Cre Species S. cerevisiae … WebFlp-mediated excision of the transcriptional “Stop” leading to TGFβCA expression is represented. Primers used for DNA genotyping (panel c), RT-PCR (panel d, e and Fig. 5b–d) are represented by grey... We would like to show you a description here but the site won’t allow us.

WebJul 21, 2016 · For the stop codon knock-in mouse line (hereon known as DBH-p2a-FLPo) targeting vector, the 5’ homology arm is a 1kb fragment going from -1000 to 0 relative to the stop codon of the gene and the 3’ homology arm is a 1kb fragment extending +4 to +1003 (deleting the PAM motif of the sgRNA).

WebBackbone manufacturer Allen Institute Vector type AAV Growth in Bacteria Bacterial Resistance (s) Ampicillin, 100 μg/mL Growth Temperature 37°C Growth Strain (s) NEB Stable Copy number High Copy Gene/Insert Gene/Insert name FlpO Species Synthetic Insert Size (bp) 1296 Promoter Beta Globin minimal promoter Cloning Information ctr181wWebFLPo is a mouse codon optimized FLPe that greatly increases the FRT recombination efficiency for both in vivo and in vitro in mouse. This Ad-CMV-FLPo pre-packaged … earth stone fire gravenhurstWebGFP; green fluorescent protein; Gene ID 7011691 UniProt ID B6UPG7 Product Notes This is a product of Creative Biolabs' Hi-Affi™ recombinant antibody portfolio, which has several benefits including: • Increased sensitivity • Confirmed specificity • High repeatability • Excellent batch-to-batch consistency • Sustainable supply ctr1internaloutputWebAnti-Glutamate Receptor 2 Antibody, extracellular, clone 6C4 detects level of Glutamate Receptor 2 & has been published & validated for use in ELISA, IC, IH, IP, RIA & WB with … ctr181hWebIn addition to the viral particles, you will also receive purified AAV phSyn1 (S)-FlpO-bGHpA plasmid DNA. hSyn-driven FlpO expression. These AAV were produced with a retrograde serotype, which permits retrograde … earthstone energy stock newsWebSep 12, 2024 · In order to express the Flp recombinase in mammary gland epithelial cells, we placed the mouse codon-optimized Flp ( Flpo) under the control of the MMTV promoter. Transgenic mice were generated by pronuclear microinjection. 17 founder animals were obtained, of which ten showed germline transmission. ctr130p hoyaWebFlp recombinase is used as a tool for the generation of transgenic animals. Limitations This product is for research use only and is not approved for use in humans or in clinical … earthstone fire and ice