WebAAV pEF1a-DIO-FLPo-WPRE-hGHpA. Catalog No. PVT10893 Packing 2ug Function Mammal Editing plasmids Resistance Amp Screen / Strain Stbl3 Culture temperature 37degrees centigrade Replicon Copy ... CPE Antibody. $325.00. Write Review . Add to Cart. Add to Wishlist; Add to Compare; Write Review . Quick View. New. Human OLFM2 … WebListed below are anti-Flp antibodies from multiple suppliers. Flp is a reported alias name for the human gene HPD, or '4-hydroxyphenylpyruvate dioxygenase'. The 393 …
px330_DBH-p2a-FLPo vector map and sequence
WebPlasmid pAAV-EF1a-Flpo from Dr. Karl Deisseroth's lab contains the insert Flpo and is published in Nat Methods. 2014 Jul;11(7):763-72. doi: 10.1038/nmeth.2996. ... Learn … WebSee our retrograde AAV based on the functional catagories listed below. Narrow down the items available within a category by using the buttons. Controls Green Red Switch Other Recombinases Cre Flp VCre Dre Calcium Sensors GCaMP8f GCaMP8s GCaMP8m GCaMP7f GCaMP7s GCaMP7b GCaMP6f GCaMP6s GECO Other Biosensors … earthstone countertops
Addgene: pAAV-hSyn Con/Fon EYFP
WebJan 20, 2015 · Transgene expression profiles, anti-transgene antibody titers, and bone healing after implantation of BV- engineered pASCs into mini pigs. (A) Expression duration of bone morphogenetic protein 2 ... WebLearn more about Addgene materials from user-contributed reports describing AAV and antibody experiments. Sequence Analyzer. Basic analysis for a user-entered sequence; includes restriction sites and map. ... -FlpO-bGHpA: hSyn: none: rg* Zeng: 55634: pAAV-EF1a-mCherry-IRES-Flpo: EF1a: mCherry (not a fusion tag) 1, rg* Deisseroth: 55637: … Webflp recombinase Alt name EFS promoter driving FlpO recombinase Insert Size (bp) 212 Entrez Gene flp Promoter EF1a/EFS promoter inserted Cloning Information Cloning method Restriction Enzyme 5′ cloning site SnaI (destroyed during cloning) 3′ cloning site XbaI (not destroyed) 5′ sequencing primer ccagtacatgaccttatggg earthstone countertops gainesville georgia